×

Six3 cDNA ORF clone, Mus musculus (house mouse)

Gene Symbol Six3
Entrez Gene ID 20473
Full Name sine oculis-related homeobox 3
Synonyms E130112M24Rik, Six3a, Six3alpha, Six3b, Six3beta
General protein information
Preferred Names
homeobox protein SIX3
Names
homeobox protein SIX3
sine oculis homeobox homolog 3
sine oculis-related homeobox 3 homolog
Gene Type protein-coding
Organism Mus musculus (house mouse)
Genome

17

17 E4|17 55.42 cM

Summary lac of sum
Disorder MIM:

Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_011381 NP_035511 homeobox protein SIX3



Homo sapiens (human) SIX3 NP_005404.1
Pan troglodytes (chimpanzee) SIX3 XP_525749.4
Canis lupus familiaris (dog) SIX3 XP_538477.4
Bos taurus (cattle) SIX3 NP_001180053.1
Mus musculus (house mouse) Six3 NP_035511.2
Rattus norvegicus (Norway rat) Six3 NP_076480.1
Gallus gallus (chicken) SIX3 NP_989695.1
Danio rerio (zebrafish) six3a NP_571437.1
Xenopus (Silurana) tropicalis (western clawed frog) six3 XP_002944388.2

Component

ID Name Evidence
GO:0005634 nucleus IDA

Function

ID Name Evidence
GO:0003677 DNA binding IDA
GO:0003700 sequence-specific DNA binding transcription factor activity IEA
GO:0003705 sequence-specific enhancer binding RNA polymerase II transcription factor activity IDA
GO:0005102 receptor binding ISO
GO:0005515 protein binding IPI
GO:0043565 sequence-specific DNA binding IDA

Process

ID Name Evidence
GO:0001654 eye development IDA
GO:0006355 regulation of transcription, DNA-dependent IEA
GO:0006606 protein import into nucleus IDA
GO:0007275 multicellular organismal development IEA
GO:0007420 brain development IMP
GO:0021536 diencephalon development IGI
GO:0021537 telencephalon development IMP
GO:0021797 forebrain anterior/posterior pattern formation IGI
GO:0021797 forebrain anterior/posterior pattern formation IMP
GO:0030178 negative regulation of Wnt receptor signaling pathway IMP
GO:0043010 camera-type eye development IGI
GO:0045892 negative regulation of transcription, DNA-dependent IDA
GO:0045892 negative regulation of transcription, DNA-dependent ISO
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IDA
GO:0060235 lens induction in camera-type eye IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

Alleles of this type are documented at Mouse Genome Informatics  (MGI)

The following Six3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the Six3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OMu19606 NM_011381 Mus musculus sine oculis-related homeobox 3 (Six3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OMu19606
Accession Version NM_011381.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1002bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product homeobox protein SIX3
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CD351258.1, BC098096.1 and AC166821.2. On Sep 17, 2009 this sequence version replaced gi:118130181. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC098096.1, D83145.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849388, SAMN00849390 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
ATGGTATTCC GCTCCCCCCT AGATCTCTAT TCCTCCCACT TCTTGTTGCC AAACTTCGCC 
GATTCTCACC ACTGCTCCCT ACTTCTGGCG AGTAGCGGCG GCGGGAGCGG TGCGAGCGGC
GGCGGCGGCG GCGCGGGAGG AGGCGGCGGC GGGAACCGTG CGGGAGGCGG CGGTGCTGGC
GGAGCAGGCG GCGGCAGCGG CGGCGGCGGC TCCAGGGCCC CCCCGGAAGA GTTGTCCATG
TTCCAGTTGC CCACCCTCAA CTTCTCGCCG GAGCAGGTGG CCAGCGTCTG CGAGACGCTG
GAGGAGACGG GCGACATCGA GCGGCTGGGC CGCTTCCTCT GGTCGCTGCC CGTGGCCCCC
GGGGCGTGCG AGGCCATCAA CAAACACGAG TCGATCCTGC GCGCGCGCGC TGTCGTCGCC
TTCCACACCG GCAACTTCCG CGACCTGTAC CACATCCTGG AGAACCACAA GTTCACTAAG
GAGTCTCACG GCAAGCTGCA AGCCATGTGG CTCGAGGCGC ACTACCAGGA GGCCGAGAAG
CTGCGCGGCC GCCCGCTCGG CCCGGTGGAC AAGTACCGCG TGCGCAAGAA GTTCCCTCTG
CCGCGCACCA TCTGGGATGG CGAGCAGAAG ACCCATTGCT TCAAGGAGCG GACTCGGAGC
CTGCTGCGGG AGTGGTACCT GCAGGATCCC TACCCCAACC CCAGCAAGAA ACGCGAACTG
GCGCAGGCCA CCGGCCTCAC CCCCACACAA GTAGGCAACT GGTTTAAGAA CCGGCGACAG
CGCGACCGCG CAGCGGCGGC CAAGAACAGG CTCCAGCATC AGGCCATCGG GCCGAGCGGG
ATGCGCTCGC TGGCCGAGCC CGGCTGCCCC ACGCACGGCT CAGCAGAGTC ACCGTCCACG
GCGGCCAGCC CGACCACCAG TGTGTCCAGC CTGACGGAGC GCGCGGACAC CGGCACTTCG
ATCCTCTCGG TAACCTCCAG CGACTCGGAA TGTGATGTAT GA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_035511.2
CDS407..1408
Misc Feature(1)17..19(+)
Misc Feature(2)1031..1177(+)
Misc Feature(3)1031..1177(+)
Misc Feature(4)1034..1177(+)
Exon (1)1..1215
Gene:Six3
Gene Synonym:
Exon (2)1216..3680
Gene:Six3
Gene Synonym:
Translation
Position Chain Variation Link
55 55 -, ctctcc dbSNP:214230216
66 66 c, t dbSNP:108477568
86 86 -, gcgctctctctctctctctctctctc dbSNP:387184140
86 86 g, t dbSNP:107646773
88 88 g, t dbSNP:108230374
128 128 c, t dbSNP:108848027
286 286 c, t dbSNP:225523296
466 466 c, g dbSNP:107757269
521 521 -, gcggcggcg dbSNP:236922064
522 522 -, gcggcg dbSNP:235895111
522 522 -, cgt dbSNP:242754208
595 595 a, c, g dbSNP:258325202
817 817 c, t dbSNP:108406051
907 907 a, g dbSNP:107763965
964 964 c, t dbSNP:108517681
1583 1583 -, aa dbSNP:223062059
1584 1584 -, a dbSNP:230348439
1645 1645 c, t dbSNP:223284091
1780 1780 c, t dbSNP:247360718
1809 1809 g, t dbSNP:216565037
1860 1860 -, a dbSNP:250308336
1880 1880 -, aaa dbSNP:217814789
1882 1882 a, c dbSNP:108561915
1888 1888 -, aa dbSNP:387200409
1935 1935 -, a dbSNP:235315044
1958 1958 c, t dbSNP:233433267
1972 1972 -, aa dbSNP:244781092
1984 1984 -, a dbSNP:387512221
1999 1999 a, g dbSNP:252265425
2107 2107 -, ctctctctctct dbSNP:386850068
2148 2148 a, g dbSNP:215086007
2384 2384 -, t dbSNP:257081831
2499 2499 -, ag dbSNP:243297450
2509 2509 a, g dbSNP:237107150
2738 2738 c, t dbSNP:107925113
2795 2795 a, g dbSNP:107676939
2826 2826 -, g dbSNP:247717539
2893 2893 a, g dbSNP:230042018
3108 3108 a, c dbSNP:255399606
3150 3150 -, aaaaa dbSNP:257947368
3206 3206 a, g dbSNP:222978434
3208 3208 c, g dbSNP:241482649
3260 3260 a, g dbSNP:259037301
3343 3343 c, t dbSNP:223597137
3532 3532 g, t dbSNP:108109329
3588 3588 a, g dbSNP:264776839
3600 3600 c, t dbSNP:223145002

Target ORF information:

RefSeq Version NM_011381
Organism Mus musculus (house mouse)
Definition Mus musculus sine oculis-related homeobox 3 (Six3), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_011381

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
ATGGTATTCC GCTCCCCCCT AGATCTCTAT TCCTCCCACT TCTTGTTGCC AAACTTCGCC 
GATTCTCACC ACTGCTCCCT ACTTCTGGCG AGTAGCGGCG GCGGGAGCGG TGCGAGCGGC
GGCGGCGGCG GCGCGGGAGG AGGCGGCGGC GGGAACCGTG CGGGAGGCGG CGGTGCTGGC
GGAGCAGGCG GCGGCAGCGG CGGCGGCGGC TCCAGGGCCC CCCCGGAAGA GTTGTCCATG
TTCCAGTTGC CCACCCTCAA CTTCTCGCCG GAGCAGGTGG CCAGCGTCTG CGAGACGCTG
GAGGAGACGG GCGACATCGA GCGGCTGGGC CGCTTCCTCT GGTCGCTGCC CGTGGCCCCC
GGGGCGTGCG AGGCCATCAA CAAACACGAG TCGATCCTGC GCGCGCGCGC TGTCGTCGCC
TTCCACACCG GCAACTTCCG CGACCTGTAC CACATCCTGG AGAACCACAA GTTCACTAAG
GAGTCTCACG GCAAGCTGCA AGCCATGTGG CTCGAGGCGC ACTACCAGGA GGCCGAGAAG
CTGCGCGGCC GCCCGCTCGG CCCGGTGGAC AAGTACCGCG TGCGCAAGAA GTTCCCTCTG
CCGCGCACCA TCTGGGATGG CGAGCAGAAG ACCCATTGCT TCAAGGAGCG GACTCGGAGC
CTGCTGCGGG AGTGGTACCT GCAGGATCCC TACCCCAACC CCAGCAAGAA ACGCGAACTG
GCGCAGGCCA CCGGCCTCAC CCCCACACAA GTAGGCAACT GGTTTAAGAA CCGGCGACAG
CGCGACCGCG CAGCGGCGGC CAAGAACAGG CTCCAGCATC AGGCCATCGG GCCGAGCGGG
ATGCGCTCGC TGGCCGAGCC CGGCTGCCCC ACGCACGGCT CAGCAGAGTC ACCGTCCACG
GCGGCCAGCC CGACCACCAG TGTGTCCAGC CTGACGGAGC GCGCGGACAC CGGCACTTCG
ATCCTCTCGG TAACCTCCAG CGACTCGGAA TGTGATGTAT GA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

book

Location of transient ectodermal progenitor potential in mouse development
Development 140 (22), 4533-4543 (2013)
Li L, Liu C, Biechele S, Zhu Q, Song L, Lanner F, Jing N and Rossant J.


book

Genomic code for Sox2 binding uncovers its regulatory role in Six3 activation in the forebrain
Dev. Biol. 381 (2), 491-501 (2013)
Lee B, Song H, Rizzoti K, Son Y, Yoon J, Baek K and Jeong Y.


book

Forebrain deletion of the vesicular acetylcholine transporter results in deficits in executive function, metabolic, and RNA splicing abnormalities in the prefrontal cortex
J. Neurosci. 33 (37), 14908-14920 (2013)
Kolisnyk B, Al-Onaizi MA, Hirata PH, Guzman MS, Nikolova S, Barbash S, Soreq H, Bartha R, Prado MA and Prado VF.


book

Deficient FGF signaling causes optic nerve dysgenesis and ocular coloboma
Development 140 (13), 2711-2723 (2013)
Cai Z, Tao C, Li H, Ladher R, Gotoh N, Feng GS, Wang F and Zhang X.


book

Inhibition of Sox2-dependent activation of Shh in the ventral diencephalon by Tbx3 is required for formation of the neurohypophysis
Development 140 (11), 2299-2309 (2013)
Trowe MO, Zhao L, Weiss AC, Christoffels V, Epstein DJ and Kispert A.


book

rax, a novel paired-type homeobox gene, shows expression in the anterior neural fold and developing retina
Proc. Natl. Acad. Sci. U.S.A. 94 (7), 3088-3093 (1997)
Furukawa T, Kozak CA and Cepko CL.


book

Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism
Nature 384 (6607), 327-333 (1996)
Sornson MW, Wu W, Dasen JS, Flynn SE, Norman DJ, O'Connell SM, Gukovsky I, Carriere C, Ryan AK, Miller AP, Zuo L, Gleiberman AS, Andersen B, Beamer WG and Rosenfeld MG.


book

Identification and expression of six family genes in mouse retina
FEBS Lett. 393 (2-3), 259-263 (1996)
Kawakami K, Ohto H, Takizawa T and Saito T.


book

Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development
Development 121 (12), 4045-4055 (1995)
Oliver G, Mailhos A, Wehr R, Copeland NG, Jenkins NA and Gruss P.


book

Homeobox genes and connective tissue patterning
Development 121 (3), 693-705 (1995)
Oliver G, Wehr R, Jenkins NA, Copeland NG, Cheyette BN, Hartenstein V, Zipursky SL and Gruss P.


 
*
*
*
*