Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

Six3 sine oculis-related homeobox 3 [Mus musculus (house mouse)]

Gene Symbol Six3
Entrez Gene ID 20473
Full Name sine oculis-related homeobox 3
Synonyms E130112M24Rik, Six3a, Six3alpha, Six3b, Six3beta
General protein information
Preferred Names
homeobox protein SIX3
homeobox protein SIX3
sine oculis homeobox homolog 3
sine oculis-related homeobox 3 homolog
Gene Type protein-coding
Organism Mus musculus (house mouse)


17 E4|17 55.42 cM

Summary lac of sum
Disorder MIM:

Disorder Html:
Alleles of this type are documented at Mouse Genome Informatics  (MGI)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OMu19606 NM_011381 Mus musculus sine oculis-related homeobox 3 (Six3), mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OMu19606D
Sequence Information ORF Nucleotide Sequence (Length: 1002bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product homeobox protein SIX3
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CD351258.1, BC098096.1 and AC166821.2. On Sep 17, 2009 this sequence version replaced gi:118130181. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC098096.1, D83145.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849388, SAMN00849390 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)17..19(+)
Misc Feature(2)1031..1177(+)
Misc Feature(3)1031..1177(+)
Misc Feature(4)1034..1177(+)
Exon (1)1..1215
Gene Synonym:
Exon (2)1216..3680
Gene Synonym:
Position Chain Variation Link
55 55 -, ctctcc dbSNP:214230216
66 66 c, t dbSNP:108477568
86 86 -, gcgctctctctctctctctctctctc dbSNP:387184140
86 86 g, t dbSNP:107646773
88 88 g, t dbSNP:108230374
128 128 c, t dbSNP:108848027
286 286 c, t dbSNP:225523296
466 466 c, g dbSNP:107757269
521 521 -, gcggcggcg dbSNP:236922064
522 522 -, gcggcg dbSNP:235895111
522 522 -, cgt dbSNP:242754208
595 595 a, c, g dbSNP:258325202
817 817 c, t dbSNP:108406051
907 907 a, g dbSNP:107763965
964 964 c, t dbSNP:108517681
1583 1583 -, aa dbSNP:223062059
1584 1584 -, a dbSNP:230348439
1645 1645 c, t dbSNP:223284091
1780 1780 c, t dbSNP:247360718
1809 1809 g, t dbSNP:216565037
1860 1860 -, a dbSNP:250308336
1880 1880 -, aaa dbSNP:217814789
1882 1882 a, c dbSNP:108561915
1888 1888 -, aa dbSNP:387200409
1935 1935 -, a dbSNP:235315044
1958 1958 c, t dbSNP:233433267
1972 1972 -, aa dbSNP:244781092
1984 1984 -, a dbSNP:387512221
1999 1999 a, g dbSNP:252265425
2107 2107 -, ctctctctctct dbSNP:386850068
2148 2148 a, g dbSNP:215086007
2384 2384 -, t dbSNP:257081831
2499 2499 -, ag dbSNP:243297450
2509 2509 a, g dbSNP:237107150
2738 2738 c, t dbSNP:107925113
2795 2795 a, g dbSNP:107676939
2826 2826 -, g dbSNP:247717539
2893 2893 a, g dbSNP:230042018
3108 3108 a, c dbSNP:255399606
3150 3150 -, aaaaa dbSNP:257947368
3206 3206 a, g dbSNP:222978434
3208 3208 c, g dbSNP:241482649
3260 3260 a, g dbSNP:259037301
3343 3343 c, t dbSNP:223597137
3532 3532 g, t dbSNP:108109329
3588 3588 a, g dbSNP:264776839
3600 3600 c, t dbSNP:223145002

Target ORF information:

RefSeq Version NM_011381
Organism Mus musculus (house mouse)
Definition Mus musculus sine oculis-related homeobox 3 (Six3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.