|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pGen2.1DescriptionGenScript vector pGen2.1 is a Human cytomegalovirus (CMV) promoter-based mammalian gene expression vector. CMV promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines. A target gene can be conveniently cloned into pGEN2.1 vector at multiple cloning sites (MCS). The target protein is expressed with the FLAG tag at the N-terminal. This tag will facilitate detection and purification of the target protein using commercially available tag-specific antibodies. This vector also contains a selectable marker for mammalian cells, neomycin phosphotransferase gene, under SV40 promoter. pGen2.1 vector can be used for either transient expression or stable expression in the presence of the antibiotic G418.  Storage-20°CForward Sequencing PrimerDA0009: T7 (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0029: SD0122 Reverse (CTAGTCAGACAAAATGATGC)Detailed MapF1 ori: 1594 - 2022ColE1 ori: 3786 - 4768 Polylinker: 950 - 986 CMV Promoter: 251 - 818 SV40 Promoter: 2046 - 2391 Neomycin: 2432 - 3226 Ampicillin: 4728 - 5588 Vector Sequence and Restriction Enzyme Map Example
zoom Document
|
|
