|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
GenScript pDream2.1/MCS is an excellent expression vector. There are seven restriction enzyme sites in MCS. The gene cloned into MCS can be expressed in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
 Storage-20°CForward Sequencing PrimerDA0009: T7 (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0008: SP6 (TACGATTTAGGTGACACTATAG)Detailed MapP10 Promoter: 1657 - 1770ORF603: 45 - 1011 ORF1629: 4921 - 5427 CMV Promoter: 1026 - 1608 SV40 Promoter: 3000 - 3345 Neomycin: 3386 - 4180 pUC ori: 5605 - 6236 Ampicillin: 6237 - 7097 MCS: 1837 - 1875 Vector Sequence and Restriction Enzyme Map Example
zoom Document
|
|
