Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-U6.1/NeoDescriptionpRNA-U6.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line. It uses a U6 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 101U6 Promoter: 4829 - 77 SV40 Promoter: 850 - 1195 Neomycin: 1236 - 2030 pUC ori: 2744 - 3384 Ampicillin: 3532 - 4392 Vector Sequence and Restriction Enzyme Map Document
|
|










