Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-U6.1/HygroDescriptionpRNA-U6.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene that can be used for establishing stable cell lines. It uses a U6 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 101U6 Promoter: 4998 - 77 SV40 Promoter: 850 - 1195 Hygromycin: 1218 - 2243 pUC ori: 2913 - 3553 Ampicillin: 3701 - 4561 Vector Sequence and Restriction Enzyme Map Document
|
|










