You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Shuttle
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-H1.1/ShuttleDescriptionpRNA-H1.1/Shuttle is a GenScript adenoviral siRNA shuttle vector. It is compatible with Clontech Adeno-XTM Expression System 1. It uses H1 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4753 - 4776H1 Promoter: 4653 - 4752 SV40 Promoter: 674 - 1019 Neomycin: 1060 - 1854 pUC ori: 2568 - 3208 Ampicillin: 3356 - 4216 Vector Sequence and Restriction Enzyme Map Document
|
|










