|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-H1.1/AdenoDescriptionGenScript pRNA-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An siRNA insert can be cloned into the polylinker region under H1 promoter control. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.  Storage- 20ºCDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)Detailed MappBR322 origin: 4028 - 4695Kanamycin: 5504 - 6295 Polylinker: 506 - 529 H1 Promoter: 406 - 505 Vector Sequence and Restriction Enzyme Map Document
|
|
