Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNAT-H1.1/NeoDescriptionpRNAT-H1.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses H1 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 6102 - 6125H1 Promoter: 6002 - 6101 CMV Promoter: 37 - 624 cGFP: 641 - 1360 SV40 Promoter: 2049 - 2394 Neomycin: 2435 - 3229 pUC ori: 3943 - 4583 Ampicillin: 4731 - 5591 Vector Sequence and Restriction Enzyme Map Limited Use Label LicenseThe use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546. Document
Related Products |
|










