You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNAT-H1.1/Adeno
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNAT-H1.1/AdenoDescriptionGenScript pRNAT-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An H1 promoter is used to drive siRNA expression. The vector contains a cGFP marker under the control of cytomegalovirus (CMV) promoter*, which can be used to track transfection efficiency. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.![]() ![]() Storage-20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)Detailed MappBR322 origin: 5602 - 6269Kanamycin: 7059 - 7850 Polylinker: 2112 - 2141 H1 Promoter: 2012 - 2111 CMV Promoter: 1944 - 1356 cGFP: 1333 - 622 Vector Sequence and Restriction Enzyme Map Document
Related Products |
|











