You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNAin-H1.2/Shuttle
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNAin-H1.2/ShuttleDescriptionpRNAin-H1.2/Shuttle is a GenScript adenoviral siRNA shuttle vector. It uses an inducible H1 promoter* for siRNA expression. This promoter contains a tetracycline operator (TetO1). As a competitor, tetracycline or doxycycline can bind this operator to remove the blockade of tetracycline repressor (TetR) from H1 promoter and induce the transcription of siRNA.
pRNAin-H1.2/Shuttle is designed for mammalian transfection. It also contains a neomycin resistance gene under SV40 promoter control for establishing stable cell line. Storage-20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4727 - 4750H1 Promoter: 4627 - 4726 SV40 Promoter: 674 - 1019 Neomycin: 1060 - 1854 pUC ori: 2568 - 3208 Ampicillin: 3356 - 4216 Vector Sequence and Restriction Enzyme Map Document
|
|











