You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector: pRNAT-CMV3.2/Puro
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNAT-CMV3.2/PuroDescriptionThe human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines, than RNA-polymerase III-based promoters such as U6 and H1. In this vector, a CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites.![]() StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPuromycin: 2911 - 3510Polylinker: 584 - 651 CMV Promoter: 1 - 583 cGFP: 1598 - 2317 SV40 Promoter: 1267 - 1598 pUC ori: 4210 - 4850 Ampicillin: 4998 - 5858 Vector Sequence and Restriction Enzyme Map Document
Related Products |
|










