Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-H1.3/NeoDescriptionpRNA-H1.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.![]() ![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapCMV IE: 4559 - 5042siFluc: 5148 - 5205 Polylinker: 5142 - 5211 H1 Promoter: 5049 - 5143 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189 Vector Sequence and Restriction Enzyme Map Document
|
|











