You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNAT-H1.3/Hygro
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNAT-H1.3/HygroDescriptionpRNAT-H1.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapCMV IE: 7 - 490Polylinker: 590 - 659 H1 Promoter: 497 - 591 CMV Promoter: 698 - 1285 cGFP: 1302 - 2021 SV40 Promoter: 2710 - 3055 Hygromycin: 3078 - 4103 pUC ori: 4773 - 5413 Ampicillin: 5561 - 6421 Vector Sequence and Restriction Enzyme Map Document
Related Products |
|










