You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-U6.1/Hygro/siRLuc
|
|
Other vector |
siRNA Expression Vector |
siRNA positive control |
siRNA cassette control |
siRNA negative control
pRNA-U6.1/Hygro/siRLucDescriptionpRNA-U6.1/Hygro/siRLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses a U6 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 147U6 Promoter: 5044 - 77 SV40 Promoter: 896 - 1241 Hygromycin: 1264 - 2289 pUC ori: 2959 - 3599 Ampicillin: 3747 - 4607 Vector Sequence and Restriction Enzyme Map Document
|
|










