You are here:  Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services  »  GenScript ORF Clone: NM_001124 (Gene: ADM)

Large-scale Protein Expression and Purification GenScript offers custom protein expression and purification services (small or large scale) in E.col... Varicella Zoster Virus gE E. coli derived recombinant. The protein contains the VZV gE immunodominant regions. Varicella-zoste... CytomegaloVirus Pp65 (UL83) The protein is an E. coli-derived recombinant. The protein contains the CMV Pp65 (UL83) immunodomina...

GenScript Gene ID	Name	Size	Vector	Price
GN000629	ADM	10 ug	SD0221	$300.00

Vector:

pDream2.1/LIC Kit - SD0221

Matched Refseq Accession: NM_001124

Description:

adrenomedullin, mRNA (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005625; soluble fraction
GO:0005615; extracellular space
GO:0005179; hormone activity
GO:0007588; excretion
GO:0007565; pregnancy
GO:0008015; circulation
GO:0006171; cAMP biosynthesis
GO:0007267; cell-cell signaling
GO:0007165; signal transduction
GO:0009611; response to wounding
GO:0006701; progesterone biosynthesis

Protein Parameters:

Molecular Weight	20403
Isoelectric Point	11.45
Extinction Coefficient (M-1cm-1)	18575
Absorption Coefficient	0.91
Aliphatic Index	62.53

Sequence:

>ADM   Length: 558

atgaagctggtttccgtcgccctgatgtacctgggttcgctcgccttcctaggcgctgac
accgctcggttggatgtcgcgtcggagtttcgaaagaagtggaataagtgggctctgagt
cgtgggaagagggaactgcggatgtccagcagctaccccaccgggctcgctgacgtgaag
gccgggcctgcccagacccttattcggccccaggacatgaagggtgcctctcgaagcccc
gaagacagcagtccggatgccgcccgcatccgagtcaagcgctaccgccagagcatgaac
aacttccagggcctccggagctttggctgccgcttcgggacgtgcacggtgcagaagctg
gcacaccagatctaccagttcacagataaggacaaggacaacgtcgcccccaggagcaag
atcagcccccagggctacggccgccggcgccggcgctccctgcccgaggccggcccgggt
cggactctggtgtcttctaagccacaagcacacggggctccagcccccccgagtggaagt
gctccccactttctttag

Related Products:

Cat. No.	Product	Size	Price
RP11288	peptide : Adrenomedullin (AM) (1-52), human	1 mg	$460.75
RP11291	peptide : Adrenomedullin (AM) (13-52), human	1 mg	$375.25
RP11293	peptide : Adrenomedullin (AM) (22-52), human	1 mg	$156.75

The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on ADM:

• Functional study of ADM using GenScript vector-based siRNA.
  • Design siRNA for ADM using our popular siRNA target finder.
• Codon optimization to achieve high-level of ADM protein expression.
  
• Mutagenesis of ADM
  
• Produce Antibody for ADM using GenScript peptide antibody technology.
  • Use GenScript online tool for peptide antigen design.