|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » APLN Gene, GenScript ORF Clone: NM_017413
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN000996
| APLN | 10 ug | Vector : pDream2.1/MCS (SD0222) | $395.00 |
Matched Refseq Accession: NM_017413
Description:
apelin, AGTRL1 ligand, mRNA (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005179; hormone activityGO:0007595; lactation
GO:0006955; immune response
GO:0007165; signal transduction
Sequence:
>APLN Length: 234atgaatctgcggctctgcgtgcaggcgctcctgctgctctggctctccttgaccgcggtg tgtggagggtccctgatgccgcttcccgatgggaatgggctggaagacggcaatgtccgc cacctggtgcagcccagagggtcaaggaatgggccagggccctggcagggaggtcggagg aaattccgccgccagcggccccgcctctcccataagggacccatgcctttctga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on APLN:
- Site-directed Mutagenesis or mutant library generation for APLN gene
- Plasmid DNA preparation for vectors encoding APLN .
- High-level of APLN recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for APLN epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for APLN
- Use GenScript online tool for peptide antigen design.
- Functional study of APLN gene using GenScript vector-based siRNA.
- APLN stable cell line development for recombinant protein production or assay development.