|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » CAMP Gene, GenScript ORF Clone: NM_004345
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN002631
| CAMP | 10 ug | Vector : pDream2.1/MCS (SD0222) | $641.00 |
Matched Refseq Accession: NM_004345
Description:
cathelicidin antimicrobial peptide, mRNA (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0042742; defense response to bacteria
GO:0009613; response to pest, pathogen or parasite
Sequence:
>CAMP Length: 513atgaagacccaaagggatggccactccctggggcggtggtcactggtgctcctgctgctg ggcctggtgatgcctctggccatcattgcccaggtcctcagctacaaggaagctgtgctt cgtgctatagatggcatcaaccagcggtcctcggatgctaacctctaccgcctcctggac ctggaccccaggcccacgatggatggggacccagacacgccaaagcctgtgagcttcaca gtgaaggagacagtgtgccccaggacgacacagcagtcaccagaggattgtgacttcaag aaggacgggctggtgaagcggtgtatggggacagtgaccctcaaccaggccaggggctcc tttgacatcagttgtgataaggataacaagagatttgccctgctgggtgatttcttccgg aaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggatttt ttgcggaatcttgtacccaggacagagtcctag
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on CAMP:
- Site-directed Mutagenesis or mutant library generation for CAMP gene
- Plasmid DNA preparation for vectors encoding CAMP .
- High-level of CAMP recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for CAMP epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for CAMP
- Use GenScript online tool for peptide antigen design.
- Functional study of CAMP gene using GenScript vector-based siRNA.
- CAMP stable cell line development for recombinant protein production or assay development.