|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » GCG Gene, GenScript ORF Clone: NM_002054
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN006652
| GCG | 10 ug | Vector : pDream2.1/MCS (SD0222) | $679.00 |
Matched Refseq Accession: NM_002054
Description:
glucagon, mRNA (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005625; soluble fraction
GO:0005179; hormone activity
GO:0007631; feeding behavior
GO:0008283; cell proliferation
GO:0007165; signal transduction
GO:0007186; G-protein coupled receptor protein signaling pathway
Sequence:
>GCG Length: 543atgaaaagcatttactttgtggctggattatttgtaatgctggtacaaggcagctggcaa cgttcccttcaagacacagaggagaaatccagatcattctcagcttcccaggcagaccca ctcagtgatcctgatcagatgaacgaggacaagcgccattcacagggcacattcaccagt gactacagcaagtatctggactccaggcgtgcccaagattttgtgcagtggttgatgaat accaagaggaacaggaataacattgccaaacgtcacgatgaatttgagagacatgctgaa gggacctttaccagtgatgtaagttcttatttggaaggccaagctgccaaggaattcatt gcttggctggtgaaaggccgaggaaggcgagatttcccagaagaggtcgccattgttgaa gaacttggccgcagacatgctgatggttctttctctgatgagatgaacaccattcttgat aatcttgccgccagggactttataaactggttgattcagaccaaaatcactgacaggaaa taa
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on GCG:
- Site-directed Mutagenesis or mutant library generation for GCG gene
- Plasmid DNA preparation for vectors encoding GCG .
- High-level of GCG recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for GCG epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for GCG
- Use GenScript online tool for peptide antigen design.
- Functional study of GCG gene using GenScript vector-based siRNA.
- GCG stable cell line development for recombinant protein production or assay development.