|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » GIP Gene, Homo sapiens gastric inhibitory polypeptide, GenScript ORF Clone: NM_004123
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN006733
| GIP | 10 ug | Vector : pDream2.1/MCS (SD0222) | $578.00 |
Matched Refseq Accession: NM_004123
Description:
Homo sapiens gastric inhibitory polypeptide (GIP), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005625; soluble fraction
GO:0005179; hormone activity
GO:0007165; signal transduction
Sequence:
>GIP Length: 462atggtggccacgaagacctttgctctgctgctgctgtccctgttcctggcagtgggacta ggagagaagaaagagggtcacttcagcgctctcccctccctgcctgttggatctcatgct aaggtgagcagccctcaacctcgaggccccaggtacgcggaagggactttcatcagtgac tacagtattgccatggacaagattcaccaacaagactttgtgaactggctgctggcccaa aaggggaagaagaatgactggaaacacaacatcacccagagggaggctcgggcgctggag ctggccagtcaagctaataggaaggaggaggaggcagtggagccacagagctccccagcc aagaaccccagcgatgaagatttgctgcgggacttgctgattcaagagctgttggcctgc ttgctggatcagacaaacctctgcaggctcaggtctcggtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on GIP:
- Site-directed Mutagenesis or mutant library generation for GIP gene
- Plasmid DNA preparation for vectors encoding GIP .
- High-level of GIP recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for GIP epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for GIP
- Use GenScript online tool for peptide antigen design.
- Functional study of GIP gene using GenScript vector-based siRNA.
- GIP stable cell line development for recombinant protein production or assay development.