|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » HBB Gene, GenScript ORF Clone: XM_508242
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN007293
| HBB | 10 ug | Vector : pDream2.1/MCS (SD0222) | $555.00 |
Matched Refseq Accession: XM_508242
Description:
hemoglobin, beta, mRNA (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005833; hemoglobin complexGO:0020037; heme binding
GO:0019825; oxygen binding
GO:0005506; iron ion binding
GO:0046872; metal ion binding
GO:0005344; oxygen transporter activity
GO:0006810; transport
GO:0015671; oxygen transport
Sequence:
>HBB Length: 444atggtgcacctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaac gtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccag aggttctttgagtcctttggggatctgtccacccctgatgctgttatgggcaaccctaag gtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgcacgtggat cctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggcccatcactttggc aaagaattcaccccaccagtgcaggctgcctatcagaaagtggtggctggtgtggctaat gccctggcccacaagtatcactaa
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on HBB:
- Site-directed Mutagenesis or mutant library generation for HBB gene
- Plasmid DNA preparation for vectors encoding HBB .
- High-level of HBB recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for HBB epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for HBB
- Use GenScript online tool for peptide antigen design.
- Functional study of HBB gene using GenScript vector-based siRNA.
- HBB stable cell line development for recombinant protein production or assay development.