|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » HTN3 Gene, GenScript ORF Clone: NM_000200
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN007896
| HTN3 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $395.00 |
Matched Refseq Accession: NM_000200
Description:
histatin 3, mRNA (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0046872; metal ion binding
GO:0001503; ossification
GO:0006805; xenobiotic metabolism
GO:0050832; defense response to fungi
GO:0042742; defense response to bacteria
Sequence:
>HTN3 Length: 156atgaagttttttgtttttgctttaatcttggctctcatgctttccatgactggagctgat tcacatgcaaagagacatcatgggtataaaagaaaattccatgaaaagcatcattcacat cgaggctatagatcaaattatctgtatgacaattga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on HTN3:
- Site-directed Mutagenesis or mutant library generation for HTN3 gene
- Plasmid DNA preparation for vectors encoding HTN3 .
- High-level of HTN3 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for HTN3 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for HTN3
- Use GenScript online tool for peptide antigen design.
- Functional study of HTN3 gene using GenScript vector-based siRNA.
- HTN3 stable cell line development for recombinant protein production or assay development.