You are here:  Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services  »  GenScript ORF Clone: NM_002418 (Gene: MLN)

Tumor Necrosis Factor (TNF)-α, human TNF-α is an homotrimer with a subunit molecular mass of 17,000 Da. It plays a major role in gro... pRNAT-U6.1/Hygro siRNA Vector : pRNAT-U6.1/Hygro... pRNAT-H1.1/Neo siRNA Vector : pRNAT-H1.1/Neo...

GenScript Gene ID	Name	Size	Vector	Price
GN011044	MLN	10 ug	SD0221	$435.00

Vector:

pDream2.1/LIC Kit - SD0221

Matched Refseq Accession: NM_002418

Description:

Homo sapiens motilin (MLN), transcript variant 1, mRNA. (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005576; extracellular region
GO:0005625; soluble fraction
GO:0005179; hormone activity
GO:0007267; cell-cell signaling
GO:0050791; regulation of physiological process
GO:0007186; G-protein coupled receptor protein signaling pathway

Protein Parameters:

Molecular Weight	12902
Isoelectric Point	6.54
Extinction Coefficient (M-1cm-1)	8480
Absorption Coefficient	0.66
Aliphatic Index	84.14

Sequence:

>MLN   Length: 348

atggtatcccgtaaggctgtggctgctctgctggtggtgcatgtagctgccatgctggcc
tcccagacggaagccttcgtccccatcttcacctatggcgaactccagaggatgcaggaa
aaggaacggaataaagggcaaaagaaatccctgagtgtatggcagaggtctggggaggaa
ggtcctgtagaccctgcggagcccatcagggaagaagaaaacgaaatgatcaagctgact
gctcctctggaaattggaatgaggatgaactccagacagctggaaaagtacccggccacc
ctggaagggctgctgagtgagatgcttccccagcatgcagccaagtga

Related Products:

Cat. No.	Product	Size	Price
RP10527	peptide : Motilin, human, porcine	1 mg	$109.25

The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on MLN:

• Functional study of MLN using GenScript vector-based siRNA.
  • Design siRNA for MLN using our popular siRNA target finder.
• Codon optimization to achieve high-level of MLN protein expression.
  
• Mutagenesis of MLN
  
• Produce Antibody for MLN using GenScript peptide antibody technology.
  • Use GenScript online tool for peptide antigen design.