Site-directed Mutagenesis Services $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.

You are here:  Biology CRO for Drug Discovery »    Molecular Biology Services » Custom ORF Cloning Services  »   PNOC Gene, Homo sapiens prepronociceptin, GenScript ORF Clone: NM_006228

 

GenScript Gene ID	Name	Size	Vector	Price
GN012956	PNOC	10 ug	Vector : pDream2.1/MCS (SD0222)	$664.00

Matched Refseq Accession: NM_006228

Description:

Homo sapiens prepronociceptin (PNOC), mRNA. (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005576; extracellular region
GO:0001515; opioid peptide activity
GO:0005184; neuropeptide hormone activity
GO:0007268; synaptic transmission
GO:0007600; sensory perception
GO:0007165; signal transduction
GO:0007218; neuropeptide signaling pathway

Sequence:

>PNOC   Length: 531

atgaaagtcctgctttgtgacctgctgctgctcagtctcttctccagtgtgttcagcagt
tgtcagagggactgtctcacatgccaggagaagctccacccagccctggacagcttcgac
ctggaggtgtgcatcctcgagtgtgaagagaaggtcttccccagccccctctggactcca
tgcaccaaggtcatggccaggagctcttggcagctcagccctgccgccccagagcatgtg
gcggctgctctctaccagccgagagcttcggagatgcagcatctgcggcgaatgccccga
gtccggagcttgttccaggagcaggaagagcccgagcctggcatggaggaggctggtgag
atggagcagaagcagctgcagaagagatttgggggcttcaccggggcccggaagtcggcc
aggaagttggccaatcagaagcggttcagtgagtttatgaggcaatacttggtcctgagc
atgcagtccagccagcgccggcgcaccctgcaccagaatggtaatgtgtag

The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on PNOC:

• Site-directed Mutagenesis or mutant library generation for PNOC gene
• Plasmid DNA preparation for vectors encoding PNOC .
• High-level of PNOC recombinant protein expression achieved by GenScript Free codon optimization.
• Peptide synthesis for PNOC epitopic mapping, assay screening or other applications.
• Polyclonal antibody or monoclonal antibody production for PNOC
  • Use GenScript online tool for peptide antigen design.
• Functional study of PNOC gene using GenScript vector-based siRNA.
• PNOC stable cell line development for recombinant protein production or assay development.