|
You are here:
Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services » ORF Clone (Gene: UCN3)
|
|
Antibody Purification Services
Antibody purification services in GenScript can purify any antibody quickly and efficiently.
...
One-StepTM Multiplex Western Kit II (Goat)
Kit : One-StepTM Multiplex Western Kit II (Goat)...
One-StepTM Western Multiplex Kit II (Mouse)
Kit : One-StepTM Western Multiplex Kit II (Mouse)...
|
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN017219
| UCN3 | 10 ug | SD0221 | $607.50 |
Vector:
pDream2.1/LIC Kit - SD0221Description:
urocortin 3 (stresscopin), mRNA (cDNA Clone, ORF Clone)Protein Parameters:
| Molecular Weight | 17844 |
|---|---|
| Isoelectric Point | 10.99 |
| Extinction Coefficient (M-1cm-1) | 11522.5 |
| Absorption Coefficient | 0.65 |
| Aliphatic Index | 78.46 |
Sequence:
>UCN3   Length: 486atgctgatgccggtccacttcctgctgctcctgctgctgctcctggggggccccaggaca ggcctcccccacaagttctacaaagccaagcccatcttcagctgcctcaacaccgccctg tctgaggctgagaagggccagtgggaggatgcatccctgctgagcaagaggagcttccac tacctgcgcagcagagacgcctcttcgggagaggaggaggagggcaaagagaaaaagact ttccccatctctggggccaggggtggagccggaggcacccggtacagatacgtgtcccaa gcacagcccaggggaaagccacgccaggacacggccaagagtccccaccgcaccaagttc accctgtccctcgacgtccccaccaacatcatgaacctcctcttcaacatcgccaaggcc aagaacctgcgtgcccaggcggccgccaatgcccacctgatggcgcaaattgggaggaag aagtag
Related Products:
| Cat. No. | Product | Size | Price |
|---|---|---|---|
RP10100![]() | peptide : Urocortin III, human | 1 mg | $261.25 |
RP10214![]() | peptide : Stresscopin, human | 1 mg | $332.50 |
The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on UCN3:
- Functional study of UCN3 using GenScript vector-based siRNA.
- Design siRNA for UCN3 using our popular siRNA target finder.
- Codon optimization to achieve high-level of UCN3 protein expression.
- Mutagenesis of UCN3
- Produce Antibody for UCN3 using GenScript peptide antibody technology.
- Use GenScript online tool for peptide antigen design.








