You are here:  Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services  »  GenScript ORF Clone: NM_033106 (Gene: GALP)

Peptide Libraries Peptide libraries have become a commanding asset in the fast-growing field of proteomics and its man... Mouse Anti Human Insulin (monoclonal) Insulin, hormonesecreted by the cells of the islets of Langerhans, specific groups of cells in th... Mouse Anti Human Eotaxin-1 (monoclonal) Eotaxin is a 74 amino acid, eosinophil chemotactic CC chemokine originally found in bronchoalveolar...

GenScript Gene ID	Name	Size	Vector	Price
GN024820	GALP	10 ug	SD0221	$438.75

Vector:

pDream2.1/LIC Kit - SD0221

Matched Refseq Accession: NM_033106

Description:

Homo sapiens galanin-like peptide (GALP), mRNA. (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005576; extracellular region
GO:0005184; neuropeptide hormone activity
GO:0007218; neuropeptide signaling pathway

Protein Parameters:

Molecular Weight	12527
Isoelectric Point	6.25
Extinction Coefficient (M-1cm-1)	13980
Absorption Coefficient	1.12
Aliphatic Index	102.56

Sequence:

>GALP   Length: 351

atggctcctccctccgtccccctggtcctcctcctcgtcctcttgctgagcctggcagag
actccagcatccgcacctgcccaccggggacgaggaggctggaccctcaatagtgctggc
taccttctgggtcccgtcctccaccttccccaaatgggtgaccaagacggaaagagggag
acagcccttgagatcctagacctgtggaaggccatcgacgggctcccctactcccaccct
ccacagccctccaagaggaatgtgatggagacgtttgccaaaccagagattggagatctg
ggcatgctcagcatgaaaattcccaaggaggaagatgtcctgaagtcatag

Related Products:

Cat. No.	Product	Size	Price
RP13435	peptide : Galanin-Like Peptide, human	0.1 mg	$152.00

The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on GALP:

• Functional study of GALP using GenScript vector-based siRNA.
  • Design siRNA for GALP using our popular siRNA target finder.
• Codon optimization to achieve high-level of GALP protein expression.
  
• Mutagenesis of GALP
  
• Produce Antibody for GALP using GenScript peptide antibody technology.
  • Use GenScript online tool for peptide antigen design.