|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » AVP Gene, Homo sapiens arginine vasopressin, GenScript ORF Clone: NM_000490
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN030517
| AVP | 10 ug | Vector : pDream2.1/MCS (SD0222) | $619.00 |
Matched Refseq Accession: NM_000490
Description:
Homo sapiens arginine vasopressin (neurophysin II, antidiuretic hormone, diabetes insipidus, neurohypophyseal) (AVP), mR (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005625; soluble fraction
GO:0005185; neurohypophyseal hormone activity
GO:0042310; vasoconstriction
GO:0006833; water transport
GO:0007267; cell-cell signaling
GO:0007165; signal transduction
GO:0006091; generation of precursor metabolites and energy
Sequence:
>AVP Length: 495atgcctgacaccatgctgcccgcctgcttcctcggcctactggccttctcctccgcgtgc tacttccagaactgcccgaggggcggcaagagggccatgtccgacctggagctgagacag tgcctcccctgcggccccgggggcaaaggccgctgcttcgggcccagcatctgctgcgcg gacgagctgggctgcttcgtgggcacggctgaggcgctgcgctgccaggaggagaactac ctgccgtcgccctgccagtccggccagaaggcgtgcgggagcgggggccgctgcgccgcc ttcggcgtttgctgcaacgacgagagctgcgtgaccgagcccgagtgccgcgagggcttt caccgccgcgcccgcgccagcgaccggagcaacgccacgcagctggacgggccggccggg gccttgctgctgcggctggtgcagctggccggggcgcccgagcccttcgagcccgcccag cccgacgcctactga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on AVP:
- Site-directed Mutagenesis or mutant library generation for AVP gene
- Plasmid DNA preparation for vectors encoding AVP .
- High-level of AVP recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for AVP epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for AVP
- Use GenScript online tool for peptide antigen design.
- Functional study of AVP gene using GenScript vector-based siRNA.
- AVP stable cell line development for recombinant protein production or assay development.