|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » PTH Gene, Homo sapiens parathyroid hormone, GenScript ORF Clone: NM_000315
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN031029
| PTH | 10 ug | Vector : pDream2.1/MCS (SD0222) | $435.00 |
Matched Refseq Accession: NM_000315
Description:
Homo sapiens parathyroid hormone (PTH), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005179; hormone activity
GO:0045453; bone resorption
GO:0046058; cAMP metabolism
GO:0006874; calcium ion homeostasis
GO:0007267; cell-cell signaling
GO:0001501; skeletal development
GO:0008628; induction of apoptosis by hormones
GO:0007186; G-protein coupled receptor protein signaling pathway
Sequence:
>PTH Length: 348atgatacctgcaaaagacatggctaaagttatgattgtcatgttggcaatttgttttctt acaaaatcggatgggaaatctgttaagaagagatctgtgagtgaaatacagcttatgcat aacctgggaaaacatctgaactcgatggagagagtagaatggctgcgtaagaagctgcag gatgtgcacaattttgttgcccttggagctcctctagctcccagagatgctggttcccag aggccccgaaaaaaggaagacaatgtcttggttgagagccatgaaaaaagtcttggagag gcagacaaagctgatgtgaatgtattaactaaagctaaatcccagtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on PTH:
- Site-directed Mutagenesis or mutant library generation for PTH gene
- Plasmid DNA preparation for vectors encoding PTH .
- High-level of PTH recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for PTH epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for PTH
- Use GenScript online tool for peptide antigen design.
- Functional study of PTH gene using GenScript vector-based siRNA.
- PTH stable cell line development for recombinant protein production or assay development.