|
You are here:
Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services » GenScript ORF Clone: NM_053049 (Gene: UCN3)
|
|
One-Step IP-Western Kit (Mouse)
Kit : One-Step IP-Western Kit (Mouse)...
Mouse Anti Human Tumor Necrosis Factor-α (monoclonal)
Tumor necrosis factor is a member of a superfamily of proteins, each with 157 amino acids, which ind...
Rat Anti Mouse CD4 (monoclonal)
CD4 is a single chain transmembraneous glycoprotein (59,000 Da) which belongs to the immunoglobulin...
|
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN037271
| UCN3 | 10 ug | SD0221 | $607.50 |
Vector:
pDream2.1/LIC Kit - SD0221Matched Refseq Accession: NM_053049
Description:
Homo sapiens urocortin 3 (stresscopin) (UCN3), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005179; hormone activityProtein Parameters:
| Molecular Weight | 17943 |
|---|---|
| Isoelectric Point | 11.09 |
| Extinction Coefficient (M-1cm-1) | 11522.5 |
| Absorption Coefficient | 0.64 |
| Aliphatic Index | 78.46 |
Sequence:
>UCN3   Length: 486atgctgatgccggtccacttcctgctgctcctgctgctgctcctggggggccccaggaca ggcctcccccacaagttctacaaagccaagcccatcttcagctgcctcaacaccgccctg tctgaggctgagaagggccagtgggaggatgcatccctgctgagcaagaggagcttccac tacctgcgcagcagagacgcctcttcgggagaggaggaggagggcaaagagaaaaagact ttccccatctctggggccaggggtggagccagaggcacccggtacagatacgtgtcccaa gcacagcccaggggaaagccacgccaggacacggccaagagtccccaccgcaccaagttc accctgtccctcgacgtccccaccaacatcatgaacctcctcttcaacatcgccaaggcc aagaacctgcgtgcccaggcggccgccaatgcccacctgatggcgcaaattgggaggaag aagtag
Related Products:
| Cat. No. | Product | Size | Price |
|---|---|---|---|
RP10100![]() | peptide : Urocortin III, human | 1 mg | $261.25 |
RP10214![]() | peptide : Stresscopin, human | 1 mg | $332.50 |
The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on UCN3:
- Functional study of UCN3 using GenScript vector-based siRNA.
- Design siRNA for UCN3 using our popular siRNA target finder.
- Codon optimization to achieve high-level of UCN3 protein expression.
- Mutagenesis of UCN3
- Produce Antibody for UCN3 using GenScript peptide antibody technology.
- Use GenScript online tool for peptide antigen design.









