Site-directed Mutagenesis Services $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.

You are here:  Biology CRO for Drug Discovery »    Molecular Biology Services » Custom ORF Cloning Services  »   Melt Gene, Apis mellifera melittin, GenScript ORF Clone: NM_001011607

 

GenScript Gene ID	Name	Size	Vector	Price
GN050343	Melt	10 ug	Vector : pDream2.1/MCS (SD0222)	$395.00

Matched Refseq Accession: NM_001011607

Description:

Apis mellifera melittin (Melt), mRNA. (cDNA Clone, ORF Clone)

Sequence:

>Melt   Length: 213

atgaaattcttagtcaacgttgcccttgtttttatggtcgtgtacatttcttacatctat
gcggcccctgaaccggaaccggcaccagagccagaggcggaggcagacgcggaggcagat
ccggaagcgggaattggagcagttctgaaggtattaaccacaggattgcccgccctcata
agttggattaaacgtaagaggcaacagggttag

The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on Melt:

• Site-directed Mutagenesis or mutant library generation for Melt gene
• Plasmid DNA preparation for vectors encoding Melt .
• High-level of Melt recombinant protein expression achieved by GenScript Free codon optimization.
• Peptide synthesis for Melt epitopic mapping, assay screening or other applications.
• Polyclonal antibody or monoclonal antibody production for Melt
  • Use GenScript online tool for peptide antigen design.
• Functional study of Melt gene using GenScript vector-based siRNA.
• Melt stable cell line development for recombinant protein production or assay development.