|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Apamin Gene, Apis mellifera apamin protein, GenScript ORF Clone: NM_001011612
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN050348
| Apamin | 10 ug | Vector : pDream2.1/MCS (SD0222) | $395.00 |
Matched Refseq Accession: NM_001011612
Description:
Apis mellifera apamin protein (Apamin), mRNA. (cDNA Clone, ORF Clone)Sequence:
>Apamin Length: 141atgatttctatgctgagatgcatttacttatttttatccgttattttaataacaagctac tttgtgacaccagtaatgccttgtaattgtaaggcaccagaaactgcactttgcgcaaga cgttgtcaacagcatggataa
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Apamin:
- Site-directed Mutagenesis or mutant library generation for Apamin gene
- Plasmid DNA preparation for vectors encoding Apamin .
- High-level of Apamin recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Apamin epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Apamin
- Use GenScript online tool for peptide antigen design.
- Functional study of Apamin gene using GenScript vector-based siRNA.
- Apamin stable cell line development for recombinant protein production or assay development.