|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Mbp Gene, Mus musculus myelin basic protein, GenScript ORF Clone: NM_001025245
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN062038
| Mbp | 10 ug | Vector : pDream2.1/MCS (SD0222) | $735.00 |
Matched Refseq Accession: NM_001025245
Description:
Mus musculus myelin basic protein (Mbp), transcript variant 8, mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005198; structural molecule activityGO:0019911; structural constituent of myelin sheath
GO:0042552; myelination
Sequence:
>Mbp Length: 588atgggaaaccactctggaaagagagaattatctgctgagaaggccagtaaggatggagag attcaccgaggagaggctggaaagaagagaagcgtgggcaagctttctcagacggcctca gaggacagtgatgtgtttggggaggcagatgcgatccagaacaatgggacctcggctgag gacacggcggtgacagactccaagcacacagcagacccaaagaataactggcaaggcgcc cacccagctgacccagggaaccgcccccacttgatccgcctcttttcccgagatgccccg ggaagggaggacaacaccttcaaagacaggccctcagagtccgacgagcttcagaccatc caagaagaccccacagcagcttccggaggcctggatgtgatggcatcacagaagagaccc tcacagcgatccaagtacctggccacagcaagtaccatggaccatgccaggcatggcttc ctcccaaggcacagagacacgggcatccttgactccatcgggcgcttctttagcggtgac aggggtgcgcccaagcggggctctggcaaggtgagctccgagccgtag
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Mbp:
- Site-directed Mutagenesis or mutant library generation for Mbp gene
- Plasmid DNA preparation for vectors encoding Mbp .
- High-level of Mbp recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Mbp epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Mbp
- Use GenScript online tool for peptide antigen design.
- Functional study of Mbp gene using GenScript vector-based siRNA.
- Mbp stable cell line development for recombinant protein production or assay development.