|
You are here:
Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services » GenScript ORF Clone: NM_001037999 (Gene: Dbi)
|
|
Mouse Anti Flag-Tag mAb
Mouse Anti Flag-Tag mAb is a purified IgG2b monoclonal antibody isolated from murine ascites fluid t...
Rabbit Anti CDK2 (Phospho-Thr160) (polyclonal)
antibody : Rabbit Anti CDK2 (Phospho-Thr160) (polyclonal)...
Rabbit Anti CDC2 (Phospho-Thr161) (polyclonal)
antibody : Rabbit Anti CDC2 (Phospho-Thr161) (polyclonal)...
|
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN072314
| Dbi | 10 ug | SD0221 | $510.00 |
Vector:
pDream2.1/LIC Kit - SD0221Matched Refseq Accession: NM_001037999
Description:
Mus musculus diazepam binding inhibitor (Dbi), transcript variant 1, mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005739; mitochondrionGO:0008289; lipid binding
GO:0000062; acyl-CoA binding
GO:0006810; transport
Protein Parameters:
| Molecular Weight | 15211 |
|---|---|
| Isoelectric Point | 9.72 |
| Extinction Coefficient (M-1cm-1) | 32032.5 |
| Absorption Coefficient | 2.11 |
| Aliphatic Index | 76.10 |
Sequence:
>Dbi   Length: 408atgctgtgggtttggggacagccgggtctatttcctcagatatcccgcagctcttctggg atccgagcccagctcatagcctggggagcggaactttttcccttgcagatatgtaaaact gccacccacgccggaactgccagagagttgccggctgaatttgacaaagccgctgaggag gtgaagcgcctcaagactcagccaactgatgaagagatgctgttcatctacagtcacttc aaacaagctaccgtgggcgatgtaaatacagatcggccggggctcttggacctcaagggc aaagccaagtgggactcgtggaacaagctgaaagggacttccaaggaaagtgccatgaag acctatgtggaaaaggtagacgagctaaagaagaaatacggaatataa
Related Products:
| Cat. No. | Product | Size | Price |
|---|---|---|---|
RP17326![]() | peptide : Octaneuropeptide | 1 mg | $107.25 |
The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Dbi:
- Functional study of Dbi using GenScript vector-based siRNA.
- Design siRNA for Dbi using our popular siRNA target finder.
- Codon optimization to achieve high-level of Dbi protein expression.
- Mutagenesis of Dbi
- Produce Antibody for Dbi using GenScript peptide antibody technology.
- Use GenScript online tool for peptide antigen design.








