|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Pomc Gene, Mus musculus pro-opiomelanocortin-alpha, GenScript ORF Clone: NM_008895
|
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN073986
| Pomc | 10 ug | Vector : pDream2.1/MCS (SD0222) | $885.00 | |
| All Names | ACTH; alpha-MSH; Pomc; Pomc-1; Pomc1; Proopiomelanocortin; Pro-opiomelanocortin-alpha | ||||
| Functional Category | Secreted protein | ||||
Matched Refseq Accession: NM_008895
Description:
Mus musculus pro-opiomelanocortin-alpha (Pomc), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005179; hormone activity
GO:0007218; neuropeptide signaling pathway
Sequence:
>Pomc   Length: 708atgccgagattctgctacagtcgctcaggggccctgttgctggccctcctgcttcagacc tccatagatgtgtggagctggtgcctggagagcagccagtgccaggacctcaccacggag agcaacctgctggcttgcatccgggcttgcaaactcgacctctcgctggagacgcccgtg tttcctggcaacggagatgaacagcccctgactgaaaacccccggaagtacgtcatgggt cacttccgctgggaccgcttcggccccaggaacagcagcagtgctggcagcgcggcgcag aggcgtgcggaggaagaggcggtgtggggagatggcagtccagagccgagtccacgcgag ggcaagcgctcctactccatggagcacttccgctggggcaagccggtgggcaagaaacgg cgcccggtgaaggtgtaccccaacgttgctgagaacgagtcggcggaggcctttccccta gagttcaagagggagctggaaggcgagcggccattaggcttggagcaggtcctggagtcc gacgcggagaaggacgacgggccctaccgggtggagcacttccgctggagcaacccgccc aaggacaagcgttacggtggcttcatgacctccgagaagagccagacgcccctggtgacg ctcttcaagaacgccatcatcaagaacgcgcacaagaagggccagtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Pomc:
- Site-directed Mutagenesis or mutant library generation for Pomc gene
- Plasmid DNA preparation for vectors encoding Pomc .
- High-level of Pomc recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Pomc epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Pomc
- Use GenScript online tool for peptide antigen design.
- Functional study of Pomc gene using GenScript vector-based siRNA.
- Pomc stable cell line development for recombinant protein production or assay development.








