|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Ifna1 Gene, Mus musculus interferon alpha 1, GenScript ORF Clone: NM_010502
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN075486
| Ifna1 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $712.00 | |
| All Names | IFN-alpha-1; Interferon, alpha 1; Interferon alpha-1; Interferon-alpha 1; IFNA1; Ifa1; IFN-alpha 1; IFN-A1; IFN A1; Interferon alpha family, gene 1 | ||||
| Functional Category | Cytokine | ||||
Matched Refseq Accession: NM_010502
Description:
Mus musculus interferon alpha 1 (Ifna1), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005125; cytokine activity
GO:0005126; hematopoietin/interferon-class (D200-domain) cytokine receptor binding
GO:0006952; defense response
GO:0009615; response to virus
GO:0042830; defense response to pathogenic bacteria
Sequence:
>Ifna1 Length: 570atggctaggctctgtgctttcctgatggtcctggcggtgctgagctactggccaacctgc tctctaggatgtgaccttcctcagactcataacctcaggaacaagagagccttgacactc ctggtacaaatgaggagactctcccctctctcctgcctgaaggacaggaaggactttgga ttcccgcaggagaaggtggatgcccagcagatcaagaaggctcaagccatccctgtcctg agtgagctgacccagcagatcctgaacatcttcacatcaaaggactcatctgctgcatgg aatacaaccctcctagactcattctgcaatgacctccaccagcagctcaatgacctgcaa ggctgtctgatgcagcaggtgggggtgcaggaatttcccctgacccaggaagatgccctg ctggctgtgaggaaatacttccacaggatcactgtgtacctgagagagaagaaacacagc ccctgtgcctgggaggtggtcagagcagaagtctggagagccctgtcttcctctgccaat gtgctgggaagactgagagaagagaaatga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Ifna1:
- Site-directed Mutagenesis or mutant library generation for Ifna1 gene
- Plasmid DNA preparation for vectors encoding Ifna1 .
- High-level of Ifna1 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Ifna1 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Ifna1
- Use GenScript online tool for peptide antigen design.
- Functional study of Ifna1 gene using GenScript vector-based siRNA.
- Ifna1 stable cell line development for recombinant protein production or assay development.