You are here:  Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services  »  GenScript ORF Clone: NM_011328 (Gene: Sct)

Western Optimization Kit (Rabbit) Kit : Western Optimization Kit (Rabbit)... Mouse Anti-Fibrillarin (monoclonal) Nop1p/Fibrillarin was originally identified as a nucleolar protein of bakers yeast, Saccharomyces ce... Mouse Anti Peripherin 2 (Monoclonal) Peripherin is a 57,000 Da Class III intermediate filament subunit found initially in sensory neurons...

GenScript Gene ID	Name	Size	Vector	Price
GN076175	Sct	10 ug	SD0221	$502.50

Vector:

pDream2.1/LIC Kit - SD0221

Matched Refseq Accession: NM_011328

Description:

Mus musculus secretin (Sct), mRNA. (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005576; extracellular region
GO:0005179; hormone activity

Protein Parameters:

Molecular Weight	14896
Isoelectric Point	5.89
Extinction Coefficient (M-1cm-1)	22062.5
Absorption Coefficient	1.48
Aliphatic Index	96.12

Sequence:

>Sct   Length: 402

atggagcctccgctgcccacgccgatgctactgctgttgctgctgctgctctccagttcc
gccgcgctccctgcacctcccaggaccccaagacactcagacggaatgttcaccagcgag
ctcagccgcttgcaggacagtgccaggctgcagcgcctgctgcagggtctggtggggaag
cgcagcgagcaggacacagaaaatatcccagagaacagcctggcccggtccaagccctta
gaggaccagctctgcttgctgtggtcgaacactcagaccctacaggactggcttctgccc
aggctgtccctggatgggtccctgtctctctggctgcctcctggaccaaggtctgctgtt
gatcgttcagagtggactgaaacaaccaggccacccagatga

Related Products:

Cat. No.	Product	Size	Price
RP12945	peptide : Secretin, mouse	0.2 mg	$142.50

The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on Sct:

• Functional study of Sct using GenScript vector-based siRNA.
  • Design siRNA for Sct using our popular siRNA target finder.
• Codon optimization to achieve high-level of Sct protein expression.
  
• Mutagenesis of Sct
  
• Produce Antibody for Sct using GenScript peptide antibody technology.
  • Use GenScript online tool for peptide antigen design.