|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Cort Gene, Rattus norvegicus cortistatin, GenScript ORF Clone: NM_012835
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN077189
| Cort | 10 ug | Vector : pDream2.1/MCS (SD0222) | $424.00 |
Matched Refseq Accession: NM_012835
Description:
Rattus norvegicus cortistatin (Cort), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005615; extracellular spaceGO:0005576; extracellular region
GO:0005179; hormone activity
GO:0005184; neuropeptide hormone activity
GO:0007218; neuropeptide signaling pathway
GO:0045187; regulation of circadian sleep/wake cycle, sleep
Sequence:
>Cort Length: 339atgggtggctgcagcacaagaggcaagcggccgtcagccctcagtctgctgctgctgctg ctgctctcggggatcgcagcctctgccctccccctggagagcggtcccaccggccaggac agtgtgcaggatgccacaggcgggaggaggaccggccttctgactttccttgcctggtgg catgagtgggcttcccaagacagctccagcaccgctttcgaagggggtaccccggagctg tctaagcggcaggaaagaccacccctccagcagcccccacaccgggataaaaagccctgc aagaacttcttctggaaaaccttctcctcgtgcaagtag
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Cort:
- Site-directed Mutagenesis or mutant library generation for Cort gene
- Plasmid DNA preparation for vectors encoding Cort .
- High-level of Cort recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Cort epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Cort
- Use GenScript online tool for peptide antigen design.
- Functional study of Cort gene using GenScript vector-based siRNA.
- Cort stable cell line development for recombinant protein production or assay development.