You are here:  Custom Services » Molecular Biology Services » Custom Cloning » Custom ORF Cloning Services  »  GenScript ORF Clone: NM_019150 (Gene: Ucn)

Protein A Resin Antibody Purification... Mouse Anti Human CD8 (monoclonal) The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates e... Mouse Anti Human CD5 (monoclonal) antibody : Mouse Anti Human CD5 (monoclonal)...

GenScript Gene ID	Name	Size	Vector	Price
GN078924	Ucn	10 ug	SD0221	$461.25

Vector:

pDream2.1/LIC Kit - SD0221

Matched Refseq Accession: NM_019150

Description:

Rattus norvegicus urocortin (Ucn), mRNA. (cDNA Clone, ORF Clone)

Gene Ontology(gene function)

GO:0005615; extracellular space
GO:0005576; extracellular region
GO:0005179; hormone activity
GO:0001664; G-protein-coupled receptor binding
GO:0006979; response to oxidative stress
GO:0007218; neuropeptide signaling pathway

Protein Parameters:

Molecular Weight	13693
Isoelectric Point	12.09
Extinction Coefficient (M-1cm-1)	11000
Absorption Coefficient	0.80
Aliphatic Index	100.00

Sequence:

>Ucn   Length: 369

atgaggcagaggggacgcgctacgctcctggtagcgttgctgcttctggttcagctgcgc
ccggagagcagccagtggagcccagcggctgcggcggcgaatgtggtccaggatccgaat
ctgcgatggaaccccggagtgcggaatcagggcggaggtgtccgcgcactcctcttgctg
ttagcggagcgcttcccgcgccgcgcgggatctgagcctgcaggcgagcggcaacgacga
gacgacccgccgttgtccatcgacctcaccttccacctgctgcggaccctgctagagcta
gctcggacacagagccagcgcgagcgcgcagagcagaaccgcatcatattcgattcggtg
ggcaagtga

Related Products:

Cat. No.	Product	Size	Price
RP10104	peptide : Urocortin, rat	1 mg	$185.25

The delivered ORF Clone in pDream2.1 vector can be expressed directly
without any further cloning work in any one of the three major protein
expression systems: Bacteria, Insect cells and Mammalian cells.

You may also need additional services on Ucn:

• Functional study of Ucn using GenScript vector-based siRNA.
  • Design siRNA for Ucn using our popular siRNA target finder.
• Codon optimization to achieve high-level of Ucn protein expression.
  
• Mutagenesis of Ucn
  
• Produce Antibody for Ucn using GenScript peptide antibody technology.
  • Use GenScript online tool for peptide antigen design.