|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Pomc2 Gene, Rattus norvegicus proopiomelanocortin, beta, GenScript ORF Clone: NM_139326
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN138783
| Pomc2 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $885.00 |
Matched Refseq Accession: NM_139326
Description:
Rattus norvegicus proopiomelanocortin, beta (endorphin, beta) (Pomc2), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005615; extracellular spaceGO:0005576; extracellular region
GO:0005179; hormone activity
GO:0007631; feeding behavior
GO:0007218; neuropeptide signaling pathway
Sequence:
>Pomc2 Length: 708atgccgagattctgctacagtcgctcaggggccctgctgctggccctcctgcttcagacc tccatagacgtgtggagctggtgcctggagagcagccagtgccaggacctcaccacggaa agcaacctgctggcttgcatccgggcctgcagactcgacctctcggcggagacgcccgtg tttccaggcaacggagatgaacagcccttgactgaaaatccccggaagtacgtcatgggt cacttccgctgggaccgcttcggccccagaaacagcagcagtgctggcggctcagcgcag aggcgtgcggaggaagagacggcggggggagatggccgtccggagccaagtccacgggag ggcaagcgctcctactccatggagcacttccgctggggcaagccggtgggcaagaagcgg cgccctgtgaaggtgtaccccaatgtcgccgagaacgagtcggccgaggcctttccccta gagttcaagagggagctggaaggcgagcagcctgatggcttggagcacgtcctggagccg gataccgagaaggccgacgggccctatcgggtggagcacttccgctggggcaacccgccc aaggacaagcgctacggcggcttcatgacctccgagaagagccagacgcccctggtgacg ctcttcaagaacgccatcatcaagaacgcgcacaagaagggccagtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Pomc2:
- Site-directed Mutagenesis or mutant library generation for Pomc2 gene
- Plasmid DNA preparation for vectors encoding Pomc2 .
- High-level of Pomc2 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Pomc2 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Pomc2
- Use GenScript online tool for peptide antigen design.
- Functional study of Pomc2 gene using GenScript vector-based siRNA.
- Pomc2 stable cell line development for recombinant protein production or assay development.