|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » Ccap Gene, Drosophila melanogaster Cardioacceleratory peptide CG4910-RA, GenScript ORF Clone: NM_142826
|
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN141766
| Ccap | 10 ug | Vector : pDream2.1/MCS (SD0222) | $585.00 |
Matched Refseq Accession: NM_142826
Description:
Drosophila melanogaster Cardioacceleratory peptide CG4910-RA (Ccap), mRNA. (cDNA Clone, ORF Clone)Sequence:
>Ccap   Length: 468atgagaacgtccatgaggatttccctgaggctgcttgcactcctggcttgtgccatttgc tctcaggcttcgctggaaagggagaacaacgagggcaccaatatggcaaatcacaagcta agtggcgttatacaatggaagtacgagaagcgaccgttttgcaatgcatttacaggctgt ggacgaaagcgtacgtatccctcgtatccgccattctcgctattcaaacgcaacgaagtc gaagagaaaccctataacaatgagtatttatccgaaggtctaagtgatttgatcgatatc aatgccgagccagctgtggaaaatgttcaaaagcaaatcatgtcgcaggccaaaatcttc gaggccatcaaagaagccagcaaggaaatctttcggcaaaagaacaaacagaaaatgttg caaaatgaaaaggagatgcagcaattggaggagcgcgaaagcaaataa
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on Ccap:
- Site-directed Mutagenesis or mutant library generation for Ccap gene
- Plasmid DNA preparation for vectors encoding Ccap .
- High-level of Ccap recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for Ccap epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for Ccap
- Use GenScript online tool for peptide antigen design.
- Functional study of Ccap gene using GenScript vector-based siRNA.
- Ccap stable cell line development for recombinant protein production or assay development.








