|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » CATHL1 Gene, Bos taurus cathelicidin 1, GenScript ORF Clone: NM_174825
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN154663
| CATHL1 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $585.00 |
Matched Refseq Accession: NM_174825
Description:
Bos taurus cathelicidin 1 (CATHL1), mRNA. (cDNA Clone, ORF Clone)Sequence:
>CATHL1 Length: 468atggagaccccgagggccagcctctccctgggacggtggtcactgtggctgctgctgctg ggactagcgctgccctcggccagcgcccaggccctcagctacagggaggccgtgcttcgt gctgtggatcagctcaatgagcaatcctcagaacctaacatttaccgtcttctcgagctg gaccagcctcctcaggatgatgaagacccagacagcccgaagcgggtgagcttcagggtg aaggagaccgtgtgctccaggaccacccagcagccccccgagcagtgtgacttcaaggag aatgggctgctgaaacgctgtgaggggacagtcaccctggaccaggtcaggggtaacttc gacatcacctgtaataatcaccagagcatcaggattacaaagcagccatgggcaccacca caggcagcccgattatgtcgcattgtagtgataagggtttgcagataa
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on CATHL1:
- Site-directed Mutagenesis or mutant library generation for CATHL1 gene
- Plasmid DNA preparation for vectors encoding CATHL1 .
- High-level of CATHL1 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for CATHL1 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for CATHL1
- Use GenScript online tool for peptide antigen design.
- Functional study of CATHL1 gene using GenScript vector-based siRNA.
- CATHL1 stable cell line development for recombinant protein production or assay development.