|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » EG208426 Gene, Mus musculus predicted gene, EG208426, GenScript ORF Clone: NM_177585
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN156444
| EG208426 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $416.00 |
Matched Refseq Accession: NM_177585
Description:
Mus musculus predicted gene, EG208426 (EG208426), mRNA. (cDNA Clone, ORF Clone)Sequence:
>EG208426 Length: 333atgcgactggaagaactaaagagactacagaatcctttagaacaagttgacgatggaaaa tatttgcttgagaatcaccagctggccatggatgtggagaataacattgagaactatccc ctcagcctacagcccttggaatcaaaggtgaaaatcatccagcgagcatggcgagagtac ttgcagaggcaggaccccctggagaagcggagcccatccccaccttctgtctcttcagac aagctgagcagctctgtcagcatgaacaccttctccgacagcagcacacccgtgagtgtc tcccggccgcttgcttggactgtcttgcactga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on EG208426:
- Site-directed Mutagenesis or mutant library generation for EG208426 gene
- Plasmid DNA preparation for vectors encoding EG208426 .
- High-level of EG208426 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for EG208426 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for EG208426
- Use GenScript online tool for peptide antigen design.
- Functional study of EG208426 gene using GenScript vector-based siRNA.
- EG208426 stable cell line development for recombinant protein production or assay development.