|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » vsnp Gene, Danio rerio vasotocin neurophysin, GenScript ORF Clone: NM_178293
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN156902
| vsnp | 10 ug | Vector : pDream2.1/MCS (SD0222) | $562.00 |
Matched Refseq Accession: NM_178293
Description:
Danio rerio vasotocin neurophysin (vsnp), mRNA. (cDNA Clone, ORF Clone)Gene Ontology(gene function)
GO:0005576; extracellular regionGO:0005179; hormone activity
GO:0005185; neurohypophyseal hormone activity
Sequence:
>vsnp Length: 450atgtcagactctctgctgtctgtgtgtgtgctgtgtgtgctcgcgctctccacgctctcg tctgcctgctacatccagaactgcccacgaggaggcaagagatcccagccggagcccatc agacagtgtatgtcgtgtggccccgggggtgtgggccgctgttttggccccagtatctgc tgtgggccaggtctgggctgtgtgctgggctccccggaggcgcaggtctgcatggaagag gagcagctgtcgggcccctgtgagaccggcgggacgtcctgtggggatcgggggggacgc tgcgccgctgagggcatctgctgcgattcagagagctgcgctgtagacccagactgtcct gaaggcagcagcgcgggacttaagagcatctcaggagaaactctgctgcgtctgctcaat ctggcaacccgcagacagagacctttctga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on vsnp:
- Site-directed Mutagenesis or mutant library generation for vsnp gene
- Plasmid DNA preparation for vectors encoding vsnp .
- High-level of vsnp recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for vsnp epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for vsnp
- Use GenScript online tool for peptide antigen design.
- Functional study of vsnp gene using GenScript vector-based siRNA.
- vsnp stable cell line development for recombinant protein production or assay development.