|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » LYZ Gene, Gallus gallus lysozyme, GenScript ORF Clone: NM_205281
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN178646
| LYZ | 10 ug | Vector : pDream2.1/MCS (SD0222) | $555.00 |
Matched Refseq Accession: NM_205281
Description:
Gallus gallus lysozyme (renal amyloidosis) (LYZ), mRNA. (cDNA Clone, ORF Clone)Sequence:
>LYZ Length: 444atgaggtctttgctaatcttggtgctttgcttcctgcccctggctgctctggggaaagtc tttggacgatgtgagctggcagcggctatgaagcgtcacggacttgataactatcgggga tacagcctgggaaactgggtgtgtgttgcaaaattcgagagtaacttcaacacccaggct acaaaccgtaacaccgatgggagtaccgactacggaatcctacagatcaacagccgctgg tggtgcaacgatggcaggaccccaggctccaggaacctgtgcaacatcccgtgctcagcc ctgctgagctcagacataacagcgagcgtgaactgcgcgaagaagatcgtcagcgatgga aacggcatgagcgcgtgggtcgcctggcgcaaccgctgcaagggtaccgacgtccaggcg tggatcagaggctgccggctgtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on LYZ:
- Site-directed Mutagenesis or mutant library generation for LYZ gene
- Plasmid DNA preparation for vectors encoding LYZ .
- High-level of LYZ recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for LYZ epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for LYZ
- Use GenScript online tool for peptide antigen design.
- Functional study of LYZ gene using GenScript vector-based siRNA.
- LYZ stable cell line development for recombinant protein production or assay development.