|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » AVP Gene, Sus scrofa vasopressin, GenScript ORF Clone: NM_213952
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN186572
| AVP | 10 ug | Vector : pDream2.1/MCS (SD0222) | $626.00 |
Matched Refseq Accession: NM_213952
Description:
Sus scrofa vasopressin (AVP), mRNA. (cDNA Clone, ORF Clone)Sequence:
>AVP Length: 501atgcctgacgccactctgcccgcctgcttcctcggcctgctggccctcacctccgcttgc tacttccagaactgcccgaagggaggcaagagggccatgtccgacttggagctgagacag tgcctcccctgcggccccgggggtaaaggtcgctgcttcgggcccagtatctgctgcggg gatgagctgggctgcttcgtgggcacggccgaggcgctgcgctgccaggaggagaactac ctgccgtctccctgccagtcgggccagaagccgtgcgggagcgggggccgctgcgccgcc gccggcatctgctgcaacgacgagagctgcgtgaccgagcccgagtgccgggagggcgcc agctttctccgccgcgcccgcgccagcgaccggagcaacgcgaccctgctggacgggccg agcggggctctgctgctgcggctggtgcaactggcgggggcgcccgagcccgcggagccc gcccagcccggcgtttactga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on AVP:
- Site-directed Mutagenesis or mutant library generation for AVP gene
- Plasmid DNA preparation for vectors encoding AVP .
- High-level of AVP recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for AVP epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for AVP
- Use GenScript online tool for peptide antigen design.
- Functional study of AVP gene using GenScript vector-based siRNA.
- AVP stable cell line development for recombinant protein production or assay development.