|
You are here:
Biology CRO for Drug Discovery » Molecular Biology Services » Custom ORF Cloning Services » LOC466447 Gene, PREDICTED: Pan troglodytes hypothetical LOC466447, transcript variant 2, GenScript ORF Clone: XM_521846
 |
| GenScript Gene ID | Name | Size | Vector | Price | |
|---|---|---|---|---|---|
GN314519
| LOC466447 | 10 ug | Vector : pDream2.1/MCS (SD0222) | $555.00 |
Matched Refseq Accession: XM_521846
Description:
PREDICTED: Pan troglodytes hypothetical LOC466447, transcript variant 2 (LOC466447), mRNA. (cDNA Clone, ORF Clone)Sequence:
>LOC466447 Length: 444atgggtgtgtgtatgtgctgctttgaacctatagttgagatccagagaattgggagtgac atcatctgtaacaataaaagagcctctcttgtgaagatgatacctgcaaaagacatggct aaagttatgattgtcatgttggcaatttgttttcttacaaaatcggatgggaaatctgtt aagaagagatctgtgagtgaaatacagcttatgcataacctgggaaaacatctgaactcg atggagagagtagaatggctgcgtaagaagctgcaggatgtgcacaattttgttgccctt ggagctcctctagctcccagagatgctggttcccagaggccccgaaaaaaggaagacaat gtcttggttgagagccatgaaaaaagtcttggagaggcagacaaagctgatgtgaatgta ttaactaaagctaaatcccagtga
The delivered ORF Clone in pDream2.1 vector can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.
You may also need additional services on LOC466447:
- Site-directed Mutagenesis or mutant library generation for LOC466447 gene
- Plasmid DNA preparation for vectors encoding LOC466447 .
- High-level of LOC466447 recombinant protein expression achieved by GenScript Free codon optimization.
- Peptide synthesis for LOC466447 epitopic mapping, assay screening or other applications.
- Polyclonal antibody or monoclonal antibody production for LOC466447
- Use GenScript online tool for peptide antigen design.
- Functional study of LOC466447 gene using GenScript vector-based siRNA.
- LOC466447 stable cell line development for recombinant protein production or assay development.