You are here:  Products » Molecular Biology Products » Rapid Genomic DNA Preparation and Multiplex PCR Kit »  TissueDirectTM Multiplex PCR System

TissueDirect^TM Multiplex PCR System

Description:

TissueDirect^TM Multiplex PCR System is a powerful reagent kit for both easy and rapid genomic DNA preparation and multiplex PCR amplification. Genomic DNA is directly released from cells (tissues, mouse tails, hair shafts, and cell culture) using proprietary reagents in 12 minutes without DNA purification. The genomic DNA can be used immediately in PCR amplification of multiple gene targets (up to >1,000) or stored at 4°C for future use (stable at least 6 months at 4°C).

Key Features:

• Easy to perform: Our simple, speedy procedure extracts DNA in 12 minutes.
  
  
• High specificity: “HotStart” Script^TM DNA Polymerase (a GenScript proprietary DNA polymerase), yields highly specific amplification results.
  
  
• Multiplex PCR: GenScript multiplex PCR primers can amplify over 1,000 DNA sequences.
  
  
• Excellent sensitivity: Genomic DNA from a single sperm has been successfully used in multiplex PCR amplification of more than 1000 amplicons and subsequent DNA genotyping assays. TissueDirect can work with even the smallest amounts of tissue, preserving precious samples and permitting less invasive methods.
  

Applications:

The TissueDirect^TM PCR System can extract genomic DNA from the following types of samples:

Tissues (fresh, frozen or paraffin), tissue microdissections

Animal cells (such as those from mouse tails)

Yeast cells

Buccal cells

Cell cultures

Hair shafts

Saliva

Sperm

The resulting genomic DNA is suitable for applications such as the following:

• SNP genotyping and mutation detection
• Target detection in transgenic mice
• DNA sequencing and cloning
• Quantitative PCR

Order:

Cat.No. Name Size Price Quantity   L00194 TissueDirectTM Multiplex PCR System  100 Preps (without Enzyme) $ 113.00

Technical Manual: Download PDF file TM0173 Components: Components L00194 L00195 TD-A buffer  0.50 ml  0.5 ml  TD-B buffer  4.50 ml  4.5 ml  TD-C buffer  5.00 ml  5.0 ml  TD-D buffer  0.2 ml    2X PCR premix    1.0 ml  PCR-grade water  1.00 ml  1.0 ml  Manual  TM0173  TM0173  MSDS:  20050711104946  (PDF) PROTOCOL:  20070405224238  (PDF) Examples: Figure 1. PCR analysis of genomic DNA prepared from mouse tails. The TissueDirectTM Multiplex PCR Kit was used to prepared genomic DNA from nine pieces of tissue, each of different sizes, about 1mm, 2 mm, and 4 mm, respectively, cut from three separate mouse tails. The TissueDirectTM Multiplex PCR Kit was used in accordance with the kit instructions. All genomic DNA samples were amplified using the PCR premix in the kit. The last lane shows a negative control. The PCR products are 396 bp for the mouse Ephrin A5 gene, and the sequences of the primers are (5 to 3):TCCAGCTGTGCAGTTCTCCAAAACA and ATTCCAGAGGGGTGACTACCACATT. Figure 2. Multiplex PCR amplification of human genomic DNA extracted using the TissueDirectTM Multiplex PCR System. The sizes of the DNA samples are shown on the right. Lanes 1 and 2 show 30 HEK293 cells. Lanes 3 and 4 show breast cancer microdissections. Lanes 5 and 6 show human hair shafts. Primer set used in this experiement: No. DNA size (bp) Primer Sequence 1 142 ATTGTAGGGAAATGTCTGTCTGAT ACACCAATCTCTACATCATAAGGAG 2 133 AGTGATCATGCTGTTTTCCTC GATTTTTATCCTGTTTGTGCC 3 126 TCAAAATAATTGTTCCAAAGTAGCA AAAAATGACCTTTGCAAGTACATTT 4 119 TGATTATTGGGAAAAGATCTGAGAC ACAAACCCACTTTTCATCACA 5 112 AAGCATACCTGTGAGAGTGCACA AGGCCAATGGGTAATGGTAAATCCC 6 105 CACCTCTGACTTCTCAGGTGT GCCTCTAACATTCTGTTTAGGAGA 7 100 GTAAAGAATTCAATGAGTATGCCA CTTGTTTGCAGGGTGATGCCATTT 8 96 TGTCCCTCTGAATAATTGTAGAA ATGTCTGAGTTAAATACCACACAG 9 90 TAAGACAGTTTTCTTGGAGAGTAAACATTG TTTTTTCAAAGTCTTCAGATATGGT 10 85 CTCCAACACACAGAACAGGAGGGAGGAAT TAATGGAAGGAGTAGCCCAACT 11 80 TCATATTAAGCAACTAATATTTGTGCCATC CATCTGGTGCCCATGTGTGTC 12 76 TCCCGTCACCTGAAACTGCTGTCACC GCATATTTGGTGGAAAAGTCTACAG High-Throughput Capabilities: Figure 3. Qiagen BioRobot 9604 automation system. The TissueDirectTM Multiplex PCR System is also a high-throughput system. With the TissueDirectTM Multiplex PCR System, genomic DNA is prepared and amplified in just a few easy steps with no need for further purification such as DNA precipitation and column purification, organic extraction, or proteinase digestion. The TissueDirectTM Multiplex PCR System can be easily adapted to high-throughput automation systems such as the Qiagen BioRobot 9604 for automated nucleic acid preparation and subsequent amplification of genomic DNA from tissue in a 96-well automated format. The use of Hot-Start Taq DNA polymerase prevents amplification of nonspecific products and increases efficiency.

Related Products:   Code Name Size Price Quantity L00195  TissueDirectTM Multiplex PCR System  100 Preps (with Enzyme)  $ 159.00 L00196  BloodReadyTM Multiplex PCR System  100 Preps (without Enzyme)  $ 111.00 L00197  BloodReadyTM Multiplex PCR System  100 Preps (with Enzyme)  $ 157.00 L00200  PlantDirectTM Multiplex PCR System  100 Preps (without Enzyme)  $ 139.00 L00201  PlantDirectTM Multiplex PCR System  100 Preps (with Enzyme)  $ 159.00 L00202  BacReadyTM Multiplex PCR System  100 Preps (without Enzyme)  $ 111.00 L00203  BacReadyTM Multiplex PCR System  100 Preps (with Enzyme)  $ 157.00 E00007  Enzyme : Taq DNA Polymerase  1000 U  $ 60.00 E00007  Enzyme : Taq DNA Polymerase  50000 U  $ 2700.00 D0056  dNTP mixture, 10 mM each  0.5 ml  $ 25.24