You are here:  Products » Molecular Biology Products » Rapid Genomic DNA Preparation and Multiplex PCR Kit »  BloodReadyTM Multiplex PCR System

BloodReady^TM Multiplex PCR System

Description:

BloodReady^TM Multiplex PCR System is a powerful reagent kit for both rapid genomic DNA preparation and multiplex PCR amplification. Genomic DNA is directly released from blood cells in a single step by adding a proprietary reagent directly to blood samples without DNA purification. The genomic DNA can then be used immediately in PCR amplification of multiple gene targets (up to >1,000) or stored at 4°C for future use (stable at least 6 months at 4°C).

Key Features:

• Easy to perform: Our simple, speedy procedure extracts DNA in 12 minutes.
  
  
• High specificity: “HotStart” Script^TM DNA polymerase (a GenScript proprietary DNA polymerase), yields highly specific amplification results.
  
  
• Multiplex PCR: GenScript multiplex PCR primers can amplify over 1,000 DNA sequences.
  
  
• Excellent sensitivity: Genomic DNA from a single sperm has been successfully used in multiplex PCR amplification of more than 1000 amplicons and subsequent DNA genotyping assays. TissueDirect can work with even the smallest amounts of tissue, preserving precious samples and permitting less invasive methods.
  

Applications:

DNA preparation and PCR from blood samples for applications such as the following:

• SNP genotyping and mutation detection
• Target detection in transgenic mice
• DNA sequencing and cloning
• Quantitative PCR

Order:

Cat.No. Name Size Price Quantity   L00196 BloodReadyTM Multiplex PCR System  100 Preps (without Enzyme) $ 111.00

Technical Manual: Download PDF file TM0174 Components: Components L00196 L00197 BR-A buffer  5.00 ml  5.00 ml  BR-B buffer  0.20 ml    2X PCR premix    1.00 ml  PCR-grade water  1.00 ml  1.00 ml  Manual  TM0174  TM0174  MSDS:  20050711104608  (PDF) PROTOCOL:  20070405230211  (PDF) Examples: Shown below are a PCR analysis of genomic DNA extracted using the BloodReady™ Multiplex PCR Kit and the amplified results of a similar extraction. Figure 1. PCR analysis of genomic DNAs extracted from blood samples. Genomic DNAs were extracted from nine different blood samples and amplified using BloodReadyTM Multiplex PCR Kit according to the kit instructions. M is 100 bp DNA marker lane. Lane 1 to 9 show nine blood samples. The last lane shows a negative control. PCR products are all 142 bp long. Figure 2. Multiplex PCR amplification of human genomic DNA extracted using the BloodReadyTM Multiplex PCR Kit (L00197). The sizes of each PCR DNA molecule are shown on the right. Lane 1 and 2 show the DNA extracted from 100 blood cells. Lane 3 and 4 show DNA extracted from 25 blood cells. Lane 5 and 6 show DNA extracted from only five blood cells. Primer set used in this experiement: No. DNA size (bp) Primer sequence 1 142 ATTGTAGGGAAATGTCTGTCTGAT ACACCAATCTCTACATCATAAGGAG 2 133 AGTGATCATGCTGTTTTCCTC GATTTTTATCCTGTTTGTGCC 3 126 TCAAAATAATTGTTCCAAAGTAGCA AAAAATGACCTTTGCAAGTACATTT 4 119 TGATTATTGGGAAAAGATCTGAGAC ACAAACCCACTTTTCATCACA 5 112 AAGCATACCTGTGAGAGTGCACA AGGCCAATGGGTAATGGTAAATCCC 6 105 CACCTCTGACTTCTCAGGTGT GCCTCTAACATTCTGTTTAGGAGA 7 100 GTAAAGAATTCAATGAGTATGCCA CTTGTTTGCAGGGTGATGCCATTT 8 96 TGTCCCTCTGAATAATTGTAGAA ATGTCTGAGTTAAATACCACACAG 9 90 TAAGACAGTTTTCTTGGAGAGTAAACATTG TTTTTTCAAAGTCTTCAGATATGGT 10 85 CTCCAACACACAGAACAGGAGGGAGGAAT TAATGGAAGGAGTAGCCCAACT 11 80 TCATATTAAGCAACTAATATTTGTGCCATC CATCTGGTGCCCATGTGTGTC 12 76 TCCCGTCACCTGAAACTGCTGTCACC GCATATTTGGTGGAAAAGTCTACAG BloodReadyTM Multiplex PCR System is also a high-throughput system. Figure 3. Qiagen BioRobot 9604 automation system. The BloodReadyTM Multiplex PCR System is also a high-throughput system. With BloodReadyTM Multiplex PCR System, genomic DNA is prepared and amplified in just a few easy steps that eliminate the need for any other type of purification such as DNA precipitation and column purification, organic extraction, or proteinase digestion. The BloodReadyTM Multiplex PCR System can be easily adapted to high-throughput automation systems such as the Qiagen BioRobot 9604 for automated nucleic acid preparation and subsequent amplification of genomic DNA from tissue in a 96-well automated format. The use of hot-start Taq DNA polymerase prevents amplification of nonspecific products and increases the efficiency of the amplification of the desired sequences.

Related Products:   Code Name Size Price Quantity L00194  TissueDirectTM Multiplex PCR System  100 Preps (without Enzyme)  $ 113.00 L00200  PlantDirectTM Multiplex PCR System  100 Preps (without Enzyme)  $ 139.00 E00007  Enzyme : Taq DNA Polymerase  1000 U  $ 60.00 E00007  Enzyme : Taq DNA Polymerase  50000 U  $ 2700.00 D0056  dNTP mixture, 10 mM each  0.5 ml  $ 25.24