 |
pGS-21a
| Cat. No. | Size | Price |
|---|---|---|
SD0121-10 ug
| 10 ug | $ 140.00 |
| Full Name | pGS-21a | |
Description:The pGS-21a vector is designed for cloning, high-level expression and convenient purification of proteins fused with both 6xHis and GST. Two 6xHis sequences were introduced into the vector for easy detection and purification of fused proteins. The first 6xHis is fused to GST and the fused tag 6xHis-GST can be cleaved using enterokinase. The second 6xHis can be used for detection and further purification after the cleavage of 6xHis-GST. 
Storage Buffer and Concentration: Store at -20°C.
Forward Sequencing Primer:
DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0010: T7 Terminator (GCTAGTTATTGCTCAGCGG)
Detailed Map:
T7: 1-17
F1 ori: 1061-1516
Polylinker: 834-892
Ampicillin: 1648-2508
Vector Sequence and Restriction Enzyme Map
Related Products:
MAP:
Zoom
MSDS: 20051003104720 (PDF)
PRODUCTINFO: 20060309201623 (PDF)
 |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |