 |
pGen2.1
| Cat. No. | Size | Price |
|---|---|---|
SD0122-10 ug
| 10 ug | $ 175.00 |
| Full Name | pGen2.1 | |
Description:GenScript vector pGen2.1 is a Human cytomegalovirus (CMV) promoter-based mammalian gene expression vector. CMV promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines. A target gene can be conveniently cloned into pGEN2.1 vector at multiple cloning sites (MCS).
The target protein is expressed with the FLAG tag at the N-terminal. This tag will facilitate detection and purification of the target protein using commercially available tag-specific antibodies.
This vector also contains a selectable marker for mammalian cells, neomycin phosphotransferase gene, under SV40 promoter. pGen2.1 vector can be used for either transient expression or stable expression in the presence of the antibiotic G418.
Storage Buffer and Concentration: -20°C
Forward Sequencing Primer:
DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0029: SD0122 Reverse (CTAGTCAGACAAAATGATGC)
Detailed Map:
F1 ori: 1594-2022
ColE1 ori: 3786-4768
Polylinker: 950-986
CMV Promoter: 251-818
SV40 Promoter: 2046-2391
Neomycin: 2432-3226
Ampicillin: 4728-5588
Vector Sequence and Restriction Enzyme Map
MAP:
Zoom
MSDS: 20051003104721 (PDF)
DATASHEET: 20060323222749 (PDF)
 |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |