 |
pDream2.1-cGFP
| Cat. No. | Size | Price |
|---|---|---|
SD0220-10 ug
| 10 ug | $ 250.00 |
| Full Name | pDream2.1-cGFP | |
Description:GenScript pDream2.1-cGFP vector is a positive control vector. cGFP gene was cloned into pDream2.1/Neo and can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells. 
Storage Buffer and Concentration: - 20°C
Download Protocol: TM0180
Forward Sequencing Primer:
DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0008: SP6 (TACGATTTAGGTGACACTATAG)
Detailed Map:
T7: 1625-1641
P10 Promoter: 1667-1780
ORF603: 55-1021
ORF1629: 5613-6119
CMV Promoter: 1036-1618
cGFP: 1847-2566
SV40 Promoter: 3692-4037
Neomycin: 4078-4872
pUC ori: 6297-6928
Ampicillin: 6929-7789
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Tahir SK, Yang X, Anderson MG, Morgan-Lappe SE, Sarthy AV, Chen J, Warner RB, Ng SC, Fesik SW, Elmore SW, Rosenberg SH, Tse C. Influence of Bcl-2 family members on the cellular response of small-cell lung cancer cell lines to ABT-737. Cancer Res. Feb 2007; 67: 1176-1183
MAP:
Zoom
PRODUCTINFO: 20060110022509 (PDF)
 |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |